Detail of EST/Unigene SRR015435.28355
Acc. SRR015435.28355
Internal Acc. EIOURYN01AF0U8
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=3e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=9e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR) E-value=1e-07; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Francisella tularensis subsp. novicida (strain U112) E-value=1e-07;
Length 102 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGGTCAGTGTCAGGGAAAATCTGCCCAATATCAGGAAGCCCCAGAGCTCCCAAAATTG
CATCAACAACACAGTGAAGCAAAACGTCACCATCAGAGTGAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A