Detail of EST/Unigene SRR015435.288652
Acc. SRR015435.288652
Internal Acc. EIOURYN02JUUFB
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=6e-12; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-11; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-09; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-08; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=3e-08;
Length 109 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCTGGCTTGGGCTTGGCAGCAGTCTTCCTCATTGTAATTCTCCCATTTCCACTGATT
TCAGAAGAAGATGGTGCGAGTTTCACCGTCTTTCCGGCGAAGGTAGAGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A