Detail of EST/Unigene SRR015435.298650
Acc. SRR015435.298650
Internal Acc. EIOURYN02F3YXQ
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-16; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-16; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=2e-16; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=2e-16; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-16;
Length 108 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCCAGCAGTGTCCCATCCGTAATCACCAGGGAACTCACCAGTCAAATAGCTTGGTGA
TTCACCAGAGAATGGGCCCAAGTACTTAACACGGTCAGGACCATACCA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A