Detail of EST/Unigene SRR015435.308225
Acc. SRR015435.308225
Internal Acc. EIOURYN02GFCYR
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-12; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Arabidopsis thaliana E-value=9e-12; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Acaryochloris marina (strain MBIC 11017) E-value=2e-10; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) E-value=4e-10; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Synechococcus elongatus (strain PCC 7942) E-value=4e-10;
Length 112 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTGTAATAATTTCATTAGTTATCCAAATCCTCTTCTGTTGGAACTGTTTCCTCGCTT
CATAAGCAATCTGAACTGCACGCTCAACCCCCCAACAGAAACCATAGGACTC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A