| Detail of EST/Unigene SRR015435.319935 |
| Acc. | SRR015435.319935 |
| Internal Acc. | EIOURYN02ISXKL |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aquaporin TIP2-1 OS=Arabidopsis thaliana E-value=1e-10; Probable aquaporin TIP2-2 OS=Oryza sativa subsp. japonica E-value=1e-10; Probable aquaporin TIP-type RB7-18C OS=Nicotiana tabacum E-value=6e-09; Aquaporin TIP2-3 OS=Arabidopsis thaliana E-value=6e-09; Probable aquaporin TIP2-2 OS=Arabidopsis thaliana E-value=6e-09; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGCGGCTGGGCTTGTAGCTATTGCAGTTTGCCATGGATTTGCTCTATTCGTAGCCGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |