Detail of EST/Unigene SRR015435.336320
Acc. SRR015435.336320
Internal Acc. EIOURYN02JH6Z2
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=1e-11; Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=1e-11; Heat shock 70 kDa protein OS=Zea mays E-value=1e-11; Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=3e-11; Chloroplast envelope membrane 70 kDa heat shock-related protein OS=Spinacia oleracea E-value=3e-11;
Length 107 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTTCTAGTGGAGCCACCAACAAGTACAATATCATGGATAGAGTTCTTGTCCGTCTTA
GCATCTCTCAAACACTTTTCAACTGGTTCCATACACTTTCTGAACAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A