| Detail of EST/Unigene SRR015435.340043 |
| Acc. | SRR015435.340043 |
| Internal Acc. | EIOURYN02F2AEU |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-10; 1-deoxy-D-xylulose-5-phosphate synthase 2 OS=Rhodospirillum rubrum (strain ATCC 11170 / NCIB 8255) E-value=2e-08; 1-deoxy-D-xylulose-5-phosphate synthase 1 OS=Rhodospirillum rubrum (strain ATCC 11170 / NCIB 8255) E-value=2e-08; 1-deoxy-D-xylulose-5-phosphate synthase OS=Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6) E-value=5e-08; 1-deoxy-D-xylulose-5-phosphate synthase OS=Pseudomonas syringae pv. syringae (strain B728a) E-value=8e-08; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTCAGGAGTATCAAAAACATGATGCAAAGCCACAGTTAAATCCACAACACCTAAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |