| Detail of EST/Unigene SRR015435.348602 |
| Acc. | SRR015435.348602 |
| Internal Acc. | EIOURYN02G9GIF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=7e-12; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=2e-11; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-11; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-11; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-11; |
| Length | 128 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGACTCACTTTCCGGGAACAAAGTTTGTGGCAAAAGTCCCAGGCGTTGTTGTTAACTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |