Detail of EST/Unigene SRR015435.349066 |
Acc. | SRR015435.349066 |
Internal Acc. | EIOURYN02HF7CG |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=5e-11; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=6e-11; Chlorophyll a-b binding protein, chloroplastic OS=Physcomitrella patens subsp. patens E-value=6e-11; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-11; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=6e-11; |
Length | 102 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGTTGCTGAGCTCAAAGTGAAGGAGATCAAGAACGGCAGACTTGCTATGTTCTCCATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |