Detail of EST/Unigene SRR015435.349066
Acc. SRR015435.349066
Internal Acc. EIOURYN02HF7CG
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=5e-11; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=6e-11; Chlorophyll a-b binding protein, chloroplastic OS=Physcomitrella patens subsp. patens E-value=6e-11; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-11; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=6e-11;
Length 102 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTTGCTGAGCTCAAAGTGAAGGAGATCAAGAACGGCAGACTTGCTATGTTCTCCATG
TTTGGATTCTTTGTTCAAGCTATTGTCACTGGAAAGGGTCCA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A