| Detail of EST/Unigene SRR015435.353000 |
| Acc. | SRR015435.353000 |
| Internal Acc. | EIOURYN02G5ZVN |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Tyrosine-protein kinase transforming protein Fgr OS=Feline sarcoma virus (strain Gardner-Rasheed) E-value=2e-10; Actin OS=Scherffelia dubia E-value=2e-10; Actin, muscle OS=Styela plicata E-value=2e-10; Actin, muscle-type OS=Molgula oculata E-value=2e-10; Actin OS=Taenia solium E-value=2e-10; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGGATATGGCATCATACTTTTTACTAATGAGCTTCGAGTTGCTCCTGAGGAACACCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |