Detail of EST/Unigene SRR015435.356411
Acc. SRR015435.356411
Internal Acc. EIOURYN02IRODF
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=7e-07; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=9e-07; Chlorophyll a-b binding of LHCII type 1 protein (Fragment) OS=Raphanus sativus E-value=1e-06; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=1e-06; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-06;
Length 108 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTGACCCAGAGGCTTTTGCTGAGCTCTAAGGTTAAAAGAGATCAAGAATGGTAGACT
TGCTATGTTCTCCATGTTCGGATTCTTTGTTCAAGCTATCGTCACCGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A