| Detail of EST/Unigene SRR015435.356411 |
| Acc. | SRR015435.356411 |
| Internal Acc. | EIOURYN02IRODF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=7e-07; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=9e-07; Chlorophyll a-b binding of LHCII type 1 protein (Fragment) OS=Raphanus sativus E-value=1e-06; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=1e-06; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-06; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTGACCCAGAGGCTTTTGCTGAGCTCTAAGGTTAAAAGAGATCAAGAATGGTAGACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |