| Detail of EST/Unigene SRR015435.359908 |
| Acc. | SRR015435.359908 |
| Internal Acc. | EIOURYN02FQLQR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transcription factor MYC2 OS=Arabidopsis thaliana E-value=7e-13; Transcription factor MYC4 OS=Arabidopsis thaliana E-value=1e-12; Transcription factor ATR2 OS=Arabidopsis thaliana E-value=1e-12; Transcription factor ABA-INDUCIBLE bHLH-TYPE OS=Arabidopsis thaliana E-value=2e-12; Transcription factor bHLH3 OS=Arabidopsis thaliana E-value=6e-12; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGGCCTTATCCATTTTAGACACATTTGGGACTACGGCTCTGAGCGCGTAGAATCTTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |