| Detail of EST/Unigene SRR015435.42259 |
| Acc. | SRR015435.42259 |
| Internal Acc. | EIOURYN01BZMMF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=8e-11; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=5e-10; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=9e-10; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=2e-09; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=3e-08; |
| Length | 114 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGATCCGAAACTTTTCATAAACGGCACGAGGTCGACCAGTAAAAATGCACCGATTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |