| Detail of EST/Unigene SRR015435.46477 |
| Acc. | SRR015435.46477 |
| Internal Acc. | EIOURYN01CG3HZ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=1e-09; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=2e-09; 3-ketoacyl-CoA synthase 19 OS=Arabidopsis thaliana E-value=2e-07; 3-ketoacyl-CoA synthase 17 OS=Arabidopsis thaliana E-value=7e-07; 3-ketoacyl-CoA synthase 11 OS=Arabidopsis thaliana E-value=7e-07; |
| Length | 107 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTCCTATTCACATCCATTGATGACTTAATGAACAAAACAGGGCTGAAACCAAAAGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |