Detail of EST/Unigene SRR015435.47030
Acc. SRR015435.47030
Internal Acc. EIOURYN01DUFHA
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-11; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-11; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601) E-value=4e-08; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130) E-value=4e-08; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Leptospira borgpetersenii serovar Hardjo-bovis (strain L550) E-value=1e-07;
Length 104 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGAATTTAGAGCGCTTATCTCTTGAAGATCGAATAAAGTTCTGCCACAGGATGGGCAT
GATACATATTCCGTTTTTGTGTTCCGCATTCTGCAACCTTGAAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A