| Detail of EST/Unigene SRR015435.48212 |
| Acc. | SRR015435.48212 |
| Internal Acc. | EIOURYN01C115L |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=3e-11; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Homo sapiens E-value=1e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=3e-08; Hydroxymethylglutaryl-CoA synthase A OS=Dictyostelium discoideum E-value=4e-08; Hydroxymethylglutaryl-CoA synthase 2 OS=Blattella germanica E-value=4e-08; |
| Length | 102 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTCTATGATTTTTACAAGCCCATCCTTGACAGTGAATATCCAGTGGTTGATGGTAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |