Detail of EST/Unigene SRR015435.52852 |
Acc. | SRR015435.52852 |
Internal Acc. | EIOURYN01AV6MM |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=9e-12; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=2e-10; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=7e-07; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=7e-07; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=4e-06; |
Length | 102 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGTCCGAGAGCTGTGAGATCAATGGCTACTTCATTCCAAAAGGCTCGACACTTCTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |