| Detail of EST/Unigene SRR015435.57044 |
| Acc. | SRR015435.57044 |
| Internal Acc. | EIOURYN01CX0ZB |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=3e-12; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=3e-12; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petroselinum crispum E-value=3e-12; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Magnolia liliiflora E-value=3e-12; Glyceraldehyde-3-phosphate dehydrogenase OS=Atriplex nummularia E-value=7e-12; |
| Length | 113 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGGGTCAACCACGGACACGTCAACAGTTGGGACTCGGAAAGCCATTCCAGTTAACTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |