| Detail of EST/Unigene SRR015435.59644 |
| Acc. | SRR015435.59644 |
| Internal Acc. | EIOURYN01CDLML |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=2e-07; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. japonica E-value=2e-07; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. indica E-value=2e-07; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=9e-07; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=9e-07; |
| Length | 84 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGAAACTGAAGAACACATATGATCATTTGCTCTTCAGCAGAAGCTCACTGCTCAGTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |