| Detail of EST/Unigene SRR015435.68875 |
| Acc. | SRR015435.68875 |
| Internal Acc. | EIOURYN01C3DU5 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=1e-12; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-10; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=1e-09; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-09; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=4e-09; |
| Length | 101 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTGCGCATTGCCTGCATTCTGGGTGGGTATACTCTACGATGAGGGGTCTTTGCAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |