| Acc. |
SRR015435.69599 |
| Internal Acc. |
EIOURYN01CK62H |
| Type |
EST
|
| Annotation (Top 5 hits in Uniprot_trembl) |
Chalcone synthase 1B OS=Solanum tuberosum E-value=2e-11; Chalcone synthase OS=Raphanus sativus E-value=5e-11; Chalcone synthase OS=Matthiola incana E-value=5e-11; Chalcone synthase OS=Hypericum androsaemum E-value=5e-11; Chalcone synthase OS=Hydrangea macrophylla E-value=5e-11; |
| Length |
109 nt |
| Species |
Solanum lycopersicum |
| Belonged EST Libraries |
SRR015435; |
| Sequence |
TCAGGACTACCAACTCGCTAAGCTCCTAGGGCTTCGCCCATCAGTCAAGCGACTCATGAT
GTACCAACAAGGTTGCTTTGCCGGGGGAACAGTACTTCGCTGAGACACG
|
| EST members of Unigene |
N/A
|
| InterProScan Domain |
|
| Gene Ontology |
|
| KEGG Orthology |
|
| EC |
|
| Transcription Factor Family |
|
| Transporter Classification Family |
|
| Probeset |
|
| Corresponding NCBI Gene |
N/A
|
| Trichome-related Gene from Literature |
N/A
|