Detail of EST/Unigene SRR015435.71454
Acc. SRR015435.71454
Internal Acc. EIOURYN01A86CA
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=1e-11; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=8e-11; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=1e-10; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=3e-10; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=9e-07;
Length 111 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGACGCGATGGAGGCAACCAAAGCAGTCAAGCCACTACTCGGAGACTACTACCAATTC
GATGGTACCCCCATTTTCAAGGCAATGTGGAGGGAAGCTAAAGAGTGTCTC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A