| Detail of EST/Unigene SRR015435.76680 |
| Acc. | SRR015435.76680 |
| Internal Acc. | EIOURYN01CRNKX |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-15; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=1e-13; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=1e-10; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=3e-09; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=3e-09; |
| Length | 117 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTGAAAAATCATGACGCTAACTTCTCGAGCCGCCCACCGAACTCTGGGGCGAAACAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |