| Detail of EST/Unigene SRR015435.78211 |
| Acc. | SRR015435.78211 |
| Internal Acc. | EIOURYN01ENBMA |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain 3, chloroplastic OS=Solanum tuberosum E-value=7e-09; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Solanum lycopersicum E-value=7e-09; Ribulose bisphosphate carboxylase small chain C, chloroplastic OS=Solanum tuberosum E-value=7e-09; |
| Length | 118 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGACGCGTCCACCATTGCTAGCAAGGGAGGTTAATGTCAACGTTGTTGTTCTTCTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |