| Detail of EST/Unigene SRR015435.79659 |
| Acc. | SRR015435.79659 |
| Internal Acc. | EIOURYN01DSVOQ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=3e-11; Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-11; Allene oxide synthase OS=Parthenium argentatum E-value=8e-11; Allene oxide synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-09; Allene oxide synthase 2 OS=Oryza sativa subsp. japonica E-value=6e-09; |
| Length | 122 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTTTTTCATGGTTTGGTTTCAGATGGGTCGAGATACGAAAGAATACGATAACCACCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |