Detail of EST/Unigene SRR015435.80429
Acc. SRR015435.80429
Internal Acc. EIOURYN01BAHK9
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Arabidopsis thaliana E-value=9e-13; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-11; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Cyanothece sp. (strain PCC 7425 / ATCC 29141) E-value=7e-09; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Nostoc punctiforme (strain ATCC 29133 / PCC 73102) E-value=1e-07; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Thermosynechococcus elongatus (strain BP-1) E-value=1e-07;
Length 117 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTGGTTGAGAAAGAGAACTTCTTACCGGAGGGTCCTATTACAGTTGGGGTGACATCT
GGTGCATCCACCCCCGATAAGGTTGTTGAAGATGTCCTTATCAAGGTGTTTGATATC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A