Detail of EST/Unigene SRR015435.84945
Acc. SRR015435.84945
Internal Acc. EIOURYN01BQ8MU
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=3e-14; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-13; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Lysinibacillus sphaericus (strain C3-41) E-value=3e-06; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / NBRC 12614 / NCIMB 9131 / NCTC 9757) E-value=5e-06;
Length 110 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCTTCACAGCCTCTATCATGAGGAATATTAATCCCACCAATAATCAAAGGATAACCA
GGTTCCAATCGATGAAGGTCAAATCCATGGCCGACTCTAAAAAGGAAGAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A