Detail of EST/Unigene SRR015435.88027
Acc. SRR015435.88027
Internal Acc. EIOURYN01EWQEL
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-12; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-12; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=3e-12; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-12; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=3e-12;
Length 103 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGAGCAAGTCTACCGTTCTTGATCTCCTTCACCTTGAGCTCAGCAAATGCCTCTGGGT
CTTCAGCAAGGCCTAATGGGTCGAAGCTGCCACCAGGGTAGAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A