Detail of EST/Unigene SRR015435.88273 |
Acc. | SRR015435.88273 |
Internal Acc. | EIOURYN01CJWF5 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=2e-11; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-10; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=3e-08; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=2e-07; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=5e-07; |
Length | 106 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGTCCCTCGATTGCACTACCGTCACTCAGTATAAAACTCTTGACACTTCCATCCTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |