Detail of EST/Unigene SRR015435.95451 |
Acc. | SRR015435.95451 |
Internal Acc. | EIOURYN01A15NW |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=2e-06; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=3e-06; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=4e-06; |
Length | 102 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGCATGATCAACTACCTGAAAACACCCCAATCTTTCACAAGCATTTACGATTCTCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |