Detail of EST/Unigene SRR015436.117292 |
Acc. | SRR015436.117292 |
Internal Acc. | ESXKO2301DGKFH |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=5e-23; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=2e-11; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Rattus norvegicus E-value=3e-11; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus musculus E-value=3e-11; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=3e-11; |
Length | 260 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTCATTGATATAACATCTTCAACCTCAGTGCAAAAGCCCATGCAATCTTGTCCAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |