Detail of EST/Unigene SRR015436.129326 |
Acc. | SRR015436.129326 |
Internal Acc. | ESXKO2301C0P4U |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=6e-08; Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=3e-07; Photosystem I reaction center subunit IV, chloroplastic OS=Spinacia oleracea E-value=1e-06; Photosystem I reaction center subunit IV, chloroplastic OS=Hordeum vulgare E-value=3e-06; |
Length | 306 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTGGTGGTTACTATCCTTCCCCTACTCCTACACCTAGTACACCATCTACCCCCTCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |