| Detail of EST/Unigene SRR015436.129326 |
| Acc. | SRR015436.129326 |
| Internal Acc. | ESXKO2301C0P4U |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=6e-08; Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=3e-07; Photosystem I reaction center subunit IV, chloroplastic OS=Spinacia oleracea E-value=1e-06; Photosystem I reaction center subunit IV, chloroplastic OS=Hordeum vulgare E-value=3e-06; |
| Length | 306 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGTGGTGGTTACTATCCTTCCCCTACTCCTACACCTAGTACACCATCTACCCCCTCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |