Detail of EST/Unigene SRR015436.135971 |
Acc. | SRR015436.135971 |
Internal Acc. | ESXKO2301EK9PP |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=1e-31; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=1e-30; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-24; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-24; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=1e-24; |
Length | 272 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTGGCCATCTGGGCTTGCCAAGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |