Detail of EST/Unigene SRR015436.140390 |
Acc. | SRR015436.140390 |
Internal Acc. | ESXKO2301BUJW6 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=4e-26; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=6e-25; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ginkgo biloba E-value=2e-24; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=3e-24; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=6e-24; |
Length | 253 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTATGCTCAGTAACGCACCATCATACTCGGAACTGCCACTTTACTGGACTGATGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |