Detail of EST/Unigene SRR015436.142359 |
Acc. | SRR015436.142359 |
Internal Acc. | ESXKO2301DDW0J |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=2e-41; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=4e-41; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=9e-41; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=9e-41; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-40; |
Length | 270 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGGCTTCCACCGGGGTAGAGTGGGTCGACAACCTCACCAAGAGGTCCACCAGCAATAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |