Detail of EST/Unigene SRR015436.154967 |
Acc. | SRR015436.154967 |
Internal Acc. | ESXKO2301CTHZJ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=1e-43; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-36; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=8e-19; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=1e-16; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. japonica E-value=2e-11; |
Length | 275 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGAAAGTCGAGATGGTTGCTTGCAAAGGAATTCGTTATGTTTTGCTGGTAGCGAATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |