| Detail of EST/Unigene SRR015436.162614 |
| Acc. | SRR015436.162614 |
| Internal Acc. | ESXKO2301CJXGW |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=6e-14; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=7e-12; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=1e-09; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-09; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Spinacia oleracea E-value=2e-07; |
| Length | 279 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGACATAATCCCCAACTTGAAATTGGTTCAATGGGTCATGAGCTTGGTACTTCTTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |