Detail of EST/Unigene SRR015436.162823 |
Acc. | SRR015436.162823 |
Internal Acc. | ESXKO2301CFC4O |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=3e-14; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=3e-14; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) E-value=4e-09; Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Dictyostelium discoideum E-value=2e-08; |
Length | 243 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGCAATAGGCAGTATTTCAGTTTCAGGCCACAAGTTTTTGGGATGTTCCATGCCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |