| Detail of EST/Unigene SRR015436.162823 |
| Acc. | SRR015436.162823 |
| Internal Acc. | ESXKO2301CFC4O |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=3e-14; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=3e-14; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) E-value=4e-09; Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Dictyostelium discoideum E-value=2e-08; |
| Length | 243 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGCAATAGGCAGTATTTCAGTTTCAGGCCACAAGTTTTTGGGATGTTCCATGCCTTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |