Detail of EST/Unigene SRR015436.240832 |
Acc. | SRR015436.240832 |
Internal Acc. | ESXKO2302G9E6K |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=1e-11; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=2e-11; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=3e-11; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=9e-10; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=1e-09; |
Length | 257 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTGCAAAAGTGTATCCGTTAAAAATTAGAGAAGGAGAGAAGTCAATAATGGATGAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |