Detail of EST/Unigene SRR015436.246546 |
Acc. | SRR015436.246546 |
Internal Acc. | ESXKO2302JH6IK |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=8e-30; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=3e-25; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-23; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=2e-23; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=4e-23; |
Length | 234 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGCTTGGCAAAAGTTTCAGGGTCTGCTGAAAGTCCAGCGGTATCCCACCCGTAATCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |