Detail of EST/Unigene SRR015436.255669 |
Acc. | SRR015436.255669 |
Internal Acc. | ESXKO2302F6NQW |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-20; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=2e-20; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=2e-20; Chlorophyll a-b binding protein 13, chloroplastic OS=Petunia sp. E-value=2e-20; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-20; |
Length | 298 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGAGAGATCAAGAATGGTAGACTTGCTATGTTCTCCATGTTCGGATTCTTTGTTCAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |