| Detail of EST/Unigene SRR015436.265965 |
| Acc. | SRR015436.265965 |
| Internal Acc. | ESXKO2302IBYNF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cationic amino acid transporter 3, mitochondrial OS=Arabidopsis thaliana E-value=1e-24; Cationic amino acid transporter 2, vacuolar OS=Arabidopsis thaliana E-value=3e-21; Cationic amino acid transporter 4, vacuolar OS=Arabidopsis thaliana E-value=5e-19; Cationic amino acid transporter 4 OS=Mus musculus E-value=1e-06; Cationic amino acid transporter 9, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; |
| Length | 237 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGGTTGAGCAAAGAGAAGTACAAGCTCCAATAGTTATTATATATGCTGCCCAATTAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |