Detail of EST/Unigene SRR015436.265965 |
Acc. | SRR015436.265965 |
Internal Acc. | ESXKO2302IBYNF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cationic amino acid transporter 3, mitochondrial OS=Arabidopsis thaliana E-value=1e-24; Cationic amino acid transporter 2, vacuolar OS=Arabidopsis thaliana E-value=3e-21; Cationic amino acid transporter 4, vacuolar OS=Arabidopsis thaliana E-value=5e-19; Cationic amino acid transporter 4 OS=Mus musculus E-value=1e-06; Cationic amino acid transporter 9, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; |
Length | 237 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGGTTGAGCAAAGAGAAGTACAAGCTCCAATAGTTATTATATATGCTGCCCAATTAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |