Detail of EST/Unigene SRR015436.270362 |
Acc. | SRR015436.270362 |
Internal Acc. | ESXKO2302IIVOY |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-11; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-11; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=1e-10; |
Length | 291 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTAGAGACCGAGGCGGCCGGACATGTTTTGTTTTTTTTTCTTTTTTTTTTGTGTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |