Detail of EST/Unigene SRR015436.272504 |
Acc. | SRR015436.272504 |
Internal Acc. | ESXKO2302H942E |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=4e-11; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=8e-11; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-08; Propionyl-CoA carboxylase alpha chain, mitochondrial OS=Rattus norvegicus E-value=5e-07; |
Length | 268 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTATCAATTCTCAAGGAACACGGAGTCTAACGTTGGTATGAAGTTGAGATAAAAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |