| Detail of EST/Unigene SRR015436.280137 |
| Acc. | SRR015436.280137 |
| Internal Acc. | ESXKO2302JQ8PM |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase OS=Atriplex nummularia E-value=8e-42; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=1e-41; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=3e-41; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Dianthus caryophyllus E-value=6e-41; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Magnolia liliiflora E-value=1e-40; |
| Length | 255 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGTGAACGATCCCTTCATTTCAGTTGATTACATGACATATATGTTTAAGTATGATAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |