Detail of EST/Unigene SRR015436.28495 |
Acc. | SRR015436.28495 |
Internal Acc. | ESXKO2301CFRCX |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=4e-17; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=2e-14; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=2e-14; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=3e-14; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=3e-07; |
Length | 203 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGGGCCCAATCTACAACAACCGCGAGAGGCTACAGATCTTCCTTTCTGATGCTGGAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |