| Detail of EST/Unigene SRR015436.310013 |
| Acc. | SRR015436.310013 |
| Internal Acc. | ESXKO2302GP2W7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase leaf isozyme, chloroplastic OS=Pisum sativum E-value=1e-14; Glutamine synthetase leaf isozyme, chloroplastic OS=Medicago sativa E-value=1e-14; Glutamine synthetase leaf isozyme, chloroplastic OS=Hordeum vulgare E-value=3e-14; Glutamine synthetase, chloroplastic OS=Zea mays E-value=5e-14; Glutamine synthetase leaf isozyme, chloroplastic OS=Phaseolus vulgaris E-value=6e-14; |
| Length | 259 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGTCAGAGGCACGCCTCCCTGTGAAATTCTTCCCCTGGACCAGAATGAATCAAGTTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |