Detail of EST/Unigene SRR015436.312120 |
Acc. | SRR015436.312120 |
Internal Acc. | ESXKO2302GMDOQ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ent-cassadiene C2-hydroxylase OS=Oryza sativa subsp. japonica E-value=4e-22; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=9e-22; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-21; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=2e-21; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=3e-21; |
Length | 275 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGCAAAAGGCTCGACACTTCTCGTCAACGTTTGGGCCATTGCTCGTGATCCAAACCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |