| Detail of EST/Unigene SRR015436.315202 |
| Acc. | SRR015436.315202 |
| Internal Acc. | ESXKO2302FTGKE |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=1e-12; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=7e-12; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=6e-11; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Spinacia oleracea E-value=3e-06; |
| Length | 293 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGATCAACAATTTTTTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |