Detail of EST/Unigene SRR015436.315202 |
Acc. | SRR015436.315202 |
Internal Acc. | ESXKO2302FTGKE |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=1e-12; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=7e-12; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=6e-11; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Spinacia oleracea E-value=3e-06; |
Length | 293 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGATCAACAATTTTTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |