Detail of EST/Unigene SRR015436.319344 |
Acc. | SRR015436.319344 |
Internal Acc. | ESXKO2302I809U |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-46; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=8e-46; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=2e-45; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=5e-45; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=6e-45; |
Length | 273 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGACCATGAGGAAAACTGCTACCAAGGCCAAGCCAGCCTCCTCTGGTAGCCCATGGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |